Information

10.1: Discovering How Populations Change - Biology

10.1: Discovering How Populations Change - Biology


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

The theory of evolution by natural selection describes a mechanism for species change over time. That species change had been suggested and debated well before Darwin. The view that species were static and unchanging was grounded in the writings of Plato, yet there were also ancient Greeks that expressed evolutionary ideas.

In the eighteenth century, ideas about the evolution of animals were reintroduced by the naturalist Georges-Louis Leclerc, Comte de Buffon and even by Charles Darwin’s grandfather, Erasmus Darwin. During this time, it was also accepted that there were extinct species. At the same time, James Hutton, the Scottish naturalist, proposed that geological change occurred gradually by the accumulation of small changes from processes (over long periods of time) just like those happening today. This contrasted with the predominant view that the geology of the planet was a consequence of catastrophic events occurring during a relatively brief past. Hutton’s view was later popularized by the geologist Charles Lyell in the nineteenth century. Lyell became a friend to Darwin and his ideas were very influential on Darwin’s thinking. Lyell argued that the greater age of Earth gave more time for gradual change in species, and the process provided an analogy for gradual change in species.

In the early nineteenth century, Jean-Baptiste Lamarck published a book that detailed a mechanism for evolutionary change that is now referred to as inheritance of acquired characteristics. In Lamarck’s theory, modifications in an individual caused by its environment, or the use or disuse of a structure during its lifetime, could be inherited by its offspring and, thus, bring about change in a species. While this mechanism for evolutionary change as described by Lamarck was discredited, Lamarck’s ideas were an important influence on evolutionary thought. The inscription on the statue of Lamarck that stands at the gates of the Jardin des Plantes in Paris describes him as the “founder of the doctrine of evolution.”

Charles Darwin and Natural Selection

The actual mechanism for evolution was independently conceived of and described by two naturalists, Charles Darwin and Alfred Russell Wallace, in the mid-nineteenth century. Importantly, each spent time exploring the natural world on expeditions to the tropics. From 1831 to 1836, Darwin traveled around the world on H.M.S. Beagle, visiting South America, Australia, and the southern tip of Africa. Wallace traveled to Brazil to collect insects in the Amazon rainforest from 1848 to 1852 and to the Malay Archipelago from 1854 to 1862. Darwin’s journey, like Wallace’s later journeys in the Malay Archipelago, included stops at several island chains, the last being the Galápagos Islands (west of Ecuador). On these islands, Darwin observed species of organisms on different islands that were clearly similar, yet had distinct differences. For example, the ground finches inhabiting the Galápagos Islands comprised several species that each had a unique beak shape (Figure (PageIndex{1})). He observed both that these finches closely resembled another finch species on the mainland of South America and that the group of species in the Galápagos formed a graded series of beak sizes and shapes, with very small differences between the most similar. Darwin imagined that the island species might be all species modified from one original mainland species. In 1860, he wrote, “Seeing this gradation and diversity of structure in one small, intimately related group of birds, one might really fancy that from an original paucity of birds in this archipelago, one species had been taken and modified for different ends.”1

Wallace and Darwin both observed similar patterns in other organisms and independently conceived a mechanism to explain how and why such changes could take place. Darwin called this mechanism natural selection. Natural selection, Darwin argued, was an inevitable outcome of three principles that operated in nature. First, the characteristics of organisms are inherited, or passed from parent to offspring. Second, more offspring are produced than are able to survive; in other words, resources for survival and reproduction are limited. The capacity for reproduction in all organisms outstrips the availability of resources to support their numbers. Thus, there is a competition for those resources in each generation. Both Darwin and Wallace’s understanding of this principle came from reading an essay by the economist Thomas Malthus, who discussed this principle in relation to human populations. Third, offspring vary among each other in regard to their characteristics and those variations are inherited. Out of these three principles, Darwin and Wallace reasoned that offspring with inherited characteristics that allow them to best compete for limited resources will survive and have more offspring than those individuals with variations that are less able to compete. Because characteristics are inherited, these traits will be better represented in the next generation. This will lead to change in populations over generations in a process that Darwin called “descent with modification.”

Papers by Darwin and Wallace (Figure (PageIndex{2})) presenting the idea of natural selection were read together in 1858 before the Linnaean Society in London. The following year Darwin’s book, On the Origin of Species, was published, which outlined in considerable detail his arguments for evolution by natural selection.

Demonstrations of evolution by natural selection can be time consuming. One of the best demonstrations has been in the very birds that helped to inspire the theory, the Galápagos finches. Peter and Rosemary Grant and their colleagues have studied Galápagos finch populations every year since 1976 and have provided important demonstrations of the operation of natural selection. The Grants found changes from one generation to the next in the beak shapes of the medium ground finches on the Galápagos island of Daphne Major. The medium ground finch feeds on seeds. The birds have inherited variation in the bill shape with some individuals having wide, deep bills and others having thinner bills. Large-billed birds feed more efficiently on large, hard seeds, whereas smaller billed birds feed more efficiently on small, soft seeds. During 1977, a drought period altered vegetation on the island. After this period, the number of seeds declined dramatically: the decline in small, soft seeds was greater than the decline in large, hard seeds. The large-billed birds were able to survive better than the small-billed birds the following year. The year following the drought when the Grants measured beak sizes in the much-reduced population, they found that the average bill size was larger (Figure (PageIndex{3})). This was clear evidence for natural selection (differences in survival) of bill size caused by the availability of seeds. The Grants had studied the inheritance of bill sizes and knew that the surviving large-billed birds would tend to produce offspring with larger bills, so the selection would lead to evolution of bill size. Subsequent studies by the Grants have demonstrated selection on and evolution of bill size in this species in response to changing conditions on the island. The evolution has occurred both to larger bills, as in this case, and to smaller bills when large seeds became rare.

Variation and Adaptation

Natural selection can only take place if there is variation, or differences, among individuals in a population. Importantly, these differences must have some genetic basis; otherwise, selection will not lead to change in the next generation. This is critical because variation among individuals can be caused by non-genetic reasons, such as an individual being taller because of better nutrition rather than different genes.

Genetic diversity in a population comes from two main sources: mutation and sexual reproduction. Mutation, a change in DNA, is the ultimate source of new alleles or new genetic variation in any population. An individual that has a mutated gene might have a different trait than other individuals in the population. However, this is not always the case. A mutation can have one of three outcomes on the organisms’ appearance (or phenotype):

  • A mutation may affect the phenotype of the organism in a way that gives it reduced fitness—lower likelihood of survival, resulting in fewer offspring.
  • A mutation may produce a phenotype with a beneficial effect on fitness.
  • Many mutations, called neutral mutations, will have no effect on fitness.

Mutations may also have a whole range of effect sizes on the fitness of the organism that expresses them in their phenotype, from a small effect to a great effect. Sexual reproduction and crossing over in meiosis also lead to genetic diversity: when two parents reproduce, unique combinations of alleles assemble to produce unique genotypes and, thus, phenotypes in each of the offspring.

A heritable trait that aids the survival and reproduction of an organism in its present environment is called an adaptation. An adaptation is a “match” of the organism to the environment. Adaptation to an environment comes about when a change in the range of genetic variation occurs over time that increases or maintains the match of the population with its environment. The variations in finch beaks shifted from generation to generation providing adaptation to food availability.

Whether or not a trait is favorable depends on the environment at the time. The same traits do not always have the same relative benefit or disadvantage because environmental conditions can change. For example, finches with large bills were benefited in one climate, while small bills were a disadvantage; in a different climate, the relationship reversed.

Patterns of Evolution

The evolution of species has resulted in enormous variation in form and function. When two species evolve in different directions from a common point, it is called divergent evolution. Such divergent evolution can be seen in the forms of the reproductive organs of flowering plants, which share the same basic anatomies; however, they can look very different as a result of selection in different physical environments, and adaptation to different kinds of pollinators (Figure (PageIndex{4})).

In other cases, similar phenotypes evolve independently in distantly related species. For example, flight has evolved in both bats and insects, and they both have structures we refer to as wings, which are adaptations to flight. The wings of bats and insects, however, evolved from very different original structures. When similar structures arise through evolution independently in different species it is called convergent evolution. The wings of bats and insects are called analogous structures; they are similar in function and appearance, but do not share an origin in a common ancestor. Instead they evolved independently in the two lineages. The wings of a hummingbird and an ostrich are homologous structures, meaning they share similarities (despite their differences resulting from evolutionary divergence). The wings of hummingbirds and ostriches did not evolve independently in the hummingbird lineage and the ostrich lineage—they descended from a common ancestor with wings.

The Modern Synthesis

The mechanisms of inheritance, genetics, were not understood at the time Darwin and Wallace were developing their idea of natural selection. This lack of understanding was a stumbling block to comprehending many aspects of evolution. In fact, blending inheritance was the predominant (and incorrect) genetic theory of the time, which made it difficult to understand how natural selection might operate. Darwin and Wallace were unaware of the genetics work by Austrian monk Gregor Mendel, which was published in 1866, not long after publication of On the Origin of Species. Mendel’s work was rediscovered in the early twentieth century at which time geneticists were rapidly coming to an understanding of the basics of inheritance. Initially, the newly discovered particulate nature of genes made it difficult for biologists to understand how gradual evolution could occur. But over the next few decades genetics and evolution were integrated in what became known as the modern synthesis—the coherent understanding of the relationship between natural selection and genetics that took shape by the 1940s and is generally accepted today. In sum, the modern synthesis describes how evolutionary pressures, such as natural selection, can affect a population’s genetic makeup, and, in turn, how this can result in the gradual evolution of populations and species. The theory also connects this gradual change of a population over time, called microevolution, with the processes that gave rise to new species and higher taxonomic groups with widely divergent characters, called macroevolution.

Population Genetics

Recall that a gene for a particular character may have several variants, or alleles, that code for different traits associated with that character. For example, in the ABO blood type system in humans, three alleles determine the particular blood-type protein on the surface of red blood cells. Each individual in a population of diploid organisms can only carry two alleles for a particular gene, but more than two may be present in the individuals that make up the population. Mendel followed alleles as they were inherited from parent to offspring. In the early twentieth century, biologists began to study what happens to all the alleles in a population in a field of study known as population genetics.

Until now, we have defined evolution as a change in the characteristics of a population of organisms, but behind that phenotypic change is genetic change. In population genetic terms, evolution is defined as a change in the frequency of an allele in a population. Using the ABO system as an example, the frequency of one of the alleles, IA, is the number of copies of that allele divided by all the copies of the ABO gene in the population. For example, a study in Jordan found a frequency of IA to be 26.1 percent.2 The IB, I0 alleles made up 13.4 percent and 60.5 percent of the alleles respectively, and all of the frequencies add up to 100 percent. A change in this frequency over time would constitute evolution in the population.

There are several ways the allele frequencies of a population can change. One of those ways is natural selection. If a given allele confers a phenotype that allows an individual to have more offspring that survive and reproduce, that allele, by virtue of being inherited by those offspring, will be in greater frequency in the next generation. Since allele frequencies always add up to 100 percent, an increase in the frequency of one allele always means a corresponding decrease in one or more of the other alleles. Highly beneficial alleles may, over a very few generations, become “fixed” in this way, meaning that every individual of the population will carry the allele. Similarly, detrimental alleles may be swiftly eliminated from the gene pool, the sum of all the alleles in a population. Part of the study of population genetics is tracking how selective forces change the allele frequencies in a population over time, which can give scientists clues regarding the selective forces that may be operating on a given population. The studies of changes in wing coloration in the peppered moth from mottled white to dark in response to soot-covered tree trunks and then back to mottled white when factories stopped producing so much soot is a classic example of studying evolution in natural populations (Figure (PageIndex{5})).

In the early twentieth century, English mathematician Godfrey Hardy and German physician Wilhelm Weinberg independently provided an explanation for a somewhat counterintuitive concept. Hardy’s original explanation was in response to a misunderstanding as to why a “dominant” allele, one that masks a recessive allele, should not increase in frequency in a population until it eliminated all the other alleles. The question resulted from a common confusion about what “dominant” means, but it forced Hardy, who was not even a biologist, to point out that if there are no factors that affect an allele frequency those frequencies will remain constant from one generation to the next. This principle is now known as the Hardy-Weinberg equilibrium. The theory states that a population’s allele and genotype frequencies are inherently stable—unless some kind of evolutionary force is acting on the population, the population would carry the same alleles in the same proportions generation after generation. Individuals would, as a whole, look essentially the same and this would be unrelated to whether the alleles were dominant or recessive. The four most important evolutionary forces, which will disrupt the equilibrium, are natural selection, mutation, genetic drift, and migration into or out of a population. A fifth factor, nonrandom mating, will also disrupt the Hardy-Weinberg equilibrium but only by shifting genotype frequencies, not allele frequencies. In nonrandom mating, individuals are more likely to mate with like individuals (or unlike individuals) rather than at random. Since nonrandom mating does not change allele frequencies, it does not cause evolution directly. Natural selection has been described. Mutation creates one allele out of another one and changes an allele’s frequency by a small, but continuous amount each generation. Each allele is generated by a low, constant mutation rate that will slowly increase the allele’s frequency in a population if no other forces act on the allele. If natural selection acts against the allele, it will be removed from the population at a low rate leading to a frequency that results from a balance between selection and mutation. This is one reason that genetic diseases remain in the human population at very low frequencies. If the allele is favored by selection, it will increase in frequency. Genetic drift causes random changes in allele frequencies when populations are small. Genetic drift can often be important in evolution, as discussed in the next section. Finally, if two populations of a species have different allele frequencies, migration of individuals between them will cause frequency changes in both populations. As it happens, there is no population in which one or more of these processes are not operating, so populations are always evolving, and the Hardy-Weinberg equilibrium will never be exactly observed. However, the Hardy-Weinberg principle gives scientists a baseline expectation for allele frequencies in a non-evolving population to which they can compare evolving populations and thereby infer what evolutionary forces might be at play. The population is evolving if the frequencies of alleles or genotypes deviate from the value expected from the Hardy-Weinberg principle.

Darwin identified a special case of natural selection that he called sexual selection. Sexual selection affects an individual’s ability to mate and thus produce offspring, and it leads to the evolution of dramatic traits that often appear maladaptive in terms of survival but persist because they give their owners greater reproductive success. Sexual selection occurs in two ways: through male–male competition for mates and through female selection of mates. Male–male competition takes the form of conflicts between males, which are often ritualized, but may also pose significant threats to a male’s survival. Sometimes the competition is for territory, with females more likely to mate with males with higher quality territories. Female choice occurs when females choose a male based on a particular trait, such as feather colors, the performance of a mating dance, or the building of an elaborate structure. In some cases male–male competition and female choice combine in the mating process. In each of these cases, the traits selected for, such as fighting ability or feather color and length, become enhanced in the males. In general, it is thought that sexual selection can proceed to a point at which natural selection against a character’s further enhancement prevents its further evolution because it negatively impacts the male’s ability to survive. For example, colorful feathers or an elaborate display make the male more obvious to predators.

Summary

Evolution by natural selection arises from three conditions: individuals within a species vary, some of those variations are heritable, and organisms have more offspring than resources can support. The consequence is that individuals with relatively advantageous variations will be more likely to survive and have higher reproductive rates than those individuals with different traits. The advantageous traits will be passed on to offspring in greater proportion. Thus, the trait will have higher representation in the next and subsequent generations leading to genetic change in the population.

The modern synthesis of evolutionary theory grew out of the reconciliation of Darwin’s, Wallace’s, and Mendel’s thoughts on evolution and heredity. Population genetics is a theoretical framework for describing evolutionary change in populations through the change in allele frequencies. Population genetics defines evolution as a change in allele frequency over generations. In the absence of evolutionary forces allele frequencies will not change in a population; this is known as Hardy-Weinberg equilibrium principle. However, in all populations, mutation, natural selection, genetic drift, and migration act to change allele frequencies.

Multiple Choice

Which scientific concept did Charles Darwin and Alfred Wallace independently discover?

A. mutation
B. natural selection
C. overbreeding
D. sexual reproduction

B

Which of the following situations will lead to natural selection?

A. The seeds of two plants land near each other and one grows larger than the other.
B. Two types of fish eat the same kind of food, and one is better able to gather food than the other.
C. Male lions compete for the right to mate with females, with only one possible winner.
D. all of the above

D

What is the difference between micro- and macroevolution?

A. Microevolution describes the evolution of small organisms, such as insects, while macroevolution describes the evolution of large organisms, like people and elephants.
B. Microevolution describes the evolution of microscopic entities, such as molecules and proteins, while macroevolution describes the evolution of whole organisms.
C. Microevolution describes the evolution of populations, while macroevolution describes the emergence of new species over long periods of time.
D. Microevolution describes the evolution of organisms over their lifetimes, while macroevolution describes the evolution of organisms over multiple generations.

C

Population genetics is the study of ________.

A. how allele frequencies in a population change over time
B. populations of cells in an individual
C. the rate of population growth
D. how genes affect embryological development

A

Free Response

If a person scatters a handful of plant seeds from one species in an area, how would natural selection work in this situation?

The plants that can best use the resources of the area, including competing with other individuals for those resources, will produce more seeds themselves and those traits that allowed them to better use the resources will increase in the population of the next generation.

Explain the Hardy-Weinberg principle of equilibrium.

The Hardy-Weinberg principle of equilibrium states that a population’s allele frequencies are inherently stable. Unless an evolutionary force is acting upon the population, the population would carry the same genes at the same frequencies generation after generation, and individuals would, as a whole, look essentially the same.

Footnotes

  1. 1 Charles Darwin, Journal of Researches into the Natural History and Geology of the Countries Visited during the Voyage of H.M.S. Beagle Round the World, under the Command of Capt. Fitz Roy, R.N, 2nd. ed. (London: John Murray, 1860), http://www.archive.org/details/journalofresea00darw.
  2. 2 Sahar S. Hanania, Dhia S. Hassawi, and Nidal M. Irshaid, “Allele Frequency and Molecular Genotypes of ABO Blood Group System in a Jordanian Population,” Journal of Medical Sciences 7 (2007): 51-58, doi:10.3923/jms.2007.51.58

Glossary

adaptation
a heritable trait or behavior in an organism that aids in its survival in its present environment
analogous structure
a structure that is similar because of evolution in response to similar selection pressures resulting in convergent evolution, not similar because of descent from a common ancestor
convergent evolution
an evolution that results in similar forms on different species
divergent evolution
an evolution that results in different forms in two species with a common ancestor
gene pool
all of the alleles carried by all of the individuals in the population
genetic drift
the effect of chance on a population’s gene pool
homologous structure
a structure that is similar because of descent from a common ancestor
inheritance of acquired characteristics
a phrase that describes the mechanism of evolution proposed by Lamarck in which traits acquired by individuals through use or disuse could be passed on to their offspring thus leading to evolutionary change in the population
macroevolution
a broader scale of evolutionary changes seen over paleontological time
microevolution
the changes in a population’s genetic structure (i.e., allele frequency)
migration
the movement of individuals of a population to a new location; in population genetics it refers to the movement of individuals and their alleles from one population to another, potentially changing allele frequencies in both the old and the new population
modern synthesis
the overarching evolutionary paradigm that took shape by the 1940s and is generally accepted today
natural selection
the greater relative survival and reproduction of individuals in a population that have favorable heritable traits, leading to evolutionary change
population genetics
the study of how selective forces change the allele frequencies in a population over time

10.1: Discovering How Populations Change - Biology

By the end of this section, you will be able to:

  • Define population genetics and describe how population genetics is used in the study of the evolution of populations
  • Define the Hardy-Weinberg principle and discuss its importance

The mechanisms of inheritance, or genetics, were not understood at the time Charles Darwin and Alfred Russel Wallace were developing their idea of natural selection. This lack of understanding was a stumbling block to understanding many aspects of evolution. In fact, the predominant (and incorrect) genetic theory of the time, blending inheritance, made it difficult to understand how natural selection might operate. Darwin and Wallace were unaware of the genetics work by Austrian monk Gregor Mendel, which was published in 1866, not long after publication of Darwin’s book, On the Origin of Species. Mendel’s work was rediscovered in the early twentieth century at which time geneticists were rapidly coming to an understanding of the basics of inheritance. Initially, the newly discovered particulate nature of genes made it difficult for biologists to understand how gradual evolution could occur. But over the next few decades genetics and evolution were integrated in what became known as the modern synthesis—the coherent understanding of the relationship between natural selection and genetics that took shape by the 1940s and is generally accepted today. In sum, the modern synthesis describes how evolutionary processes, such as natural selection, can affect a population’s genetic makeup, and, in turn, how this can result in the gradual evolution of populations and species. The theory also connects this change of a population over time, called microevolution, with the processes that gave rise to new species and higher taxonomic groups with widely divergent characters, called macroevolution.

Everyday Connection

Every fall, the media starts reporting on flu vaccinations and potential outbreaks. Scientists, health experts, and institutions determine recommendations for different parts of the population, predict optimal production and inoculation schedules, create vaccines, and set up clinics to provide inoculations. You may think of the annual flu shot as a lot of media hype, an important health protection, or just a briefly uncomfortable prick in your arm. But do you think of it in terms of evolution?

The media hype of annual flu shots is scientifically grounded in our understanding of evolution. Each year, scientists across the globe strive to predict the flu strains that they anticipate being most widespread and harmful in the coming year. This knowledge is based in how flu strains have evolved over time and over the past few flu seasons. Scientists then work to create the most effective vaccine to combat those selected strains. Hundreds of millions of doses are produced in a short period in order to provide vaccinations to key populations at the optimal time.

Because viruses, like the flu, evolve very quickly (especially in evolutionary time), this poses quite a challenge. Viruses mutate and replicate at a fast rate, so the vaccine developed to protect against last year’s flu strain may not provide the protection needed against the coming year’s strain. Evolution of these viruses means continued adaptions to ensure survival, including adaptations to survive previous vaccines.


Whole-genome resequencing reveals Brassica napus origin and genetic loci involved in its improvement

Brassica napus (2n = 4x = 38, AACC) is an important allopolyploid crop derived from interspecific crosses between Brassica rapa (2n = 2x = 20, AA) and Brassica oleracea (2n = 2x = 18, CC). However, no truly wild B. napus populations are known its origin and improvement processes remain unclear. Here, we resequence 588 B. napus accessions. We uncover that the A subgenome may evolve from the ancestor of European turnip and the C subgenome may evolve from the common ancestor of kohlrabi, cauliflower, broccoli, and Chinese kale. Additionally, winter oilseed may be the original form of B. napus. Subgenome-specific selection of defense-response genes has contributed to environmental adaptation after formation of the species, whereas asymmetrical subgenomic selection has led to ecotype change. By integrating genome-wide association studies, selection signals, and transcriptome analyses, we identify genes associated with improved stress tolerance, oil content, seed quality, and ecotype improvement. They are candidates for further functional characterization and genetic improvement of B. napus.

Conflict of interest statement

The authors declare no competing interests.

Figures

Geographic distribution and population structure…

Geographic distribution and population structure of B. napus accessions. a Geographic distribution of…

Population structure of 588 B.…

Population structure of 588 B. napus accessions and 199 of B. rapa accessions.…

Population structure of 588 B.…

Population structure of 588 B. napus accessions and 119 of B. oleracea accessions.…

Genome-wide scanning and annotations of…

Genome-wide scanning and annotations of selected regions during the SSI of B. napus…

Overview of flowering-time regulation under…

Overview of flowering-time regulation under the selection of the ecotype improvement of B.…


Abstract

Common genetic variants of mitochondrial DNA (mtDNA) increase the risk of developing several of the major health issues facing the western world, including neurodegenerative diseases. In this Review, we consider how these mtDNA variants arose and how they spread from their origin on one single molecule in a single cell to be present at high levels throughout a specific organ and, ultimately, to contribute to the population risk of common age-related disorders. mtDNA persists in all aerobic eukaryotes, despite a high substitution rate, clonal propagation and little evidence of recombination. Recent studies have found that de novo mtDNA mutations are suppressed in the female germ line despite this, mtDNA heteroplasmy is remarkably common. The demonstration of a mammalian mtDNA genetic bottleneck explains how new germline variants can increase to high levels within a generation, and the ultimate fixation of less-severe mutations that escape germline selection explains how they can contribute to the risk of late-onset disorders.


Challenges and emerging systems biology approaches to discover how the human gut microbiome impact host physiology

Research in the human gut microbiome has bloomed with advances in next generation sequencing (NGS) and other high-throughput molecular profiling technologies. This has enabled the generation of multi-omics datasets which holds promises for big data–enabled knowledge acquisition in the form of understanding the normal physiological and pathological involvement of gut microbiomes. Ample evidence suggests that distinct microbial compositions in the human gut are associated with different diseases. However, the biological mechanisms underlying these associations are often unclear. There is a need to move beyond statistical associations to discover how changes in the gut microbiota mechanistically affect host physiology and disease development. This review summarises state-of-the-art big data and systems biology approaches for mechanism discovery.

This is a preview of subscription content, access via your institution.


Materials and methods

Preparation of total RNA

Total RNA was extracted using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) from mixed-stage (including embryos, every instar larvae and adults) Locusta migratoria that we fed in our lab. We collected 0-1, 2-3, 4-5, 6-7, 8-9, 10-11, 12-13 and 14-15 day-old embryos cultured at 30°C in clean sand with relative humidity. For the larvae, we collected the whole body except the midgut and pooled them to ensure every instar was present in the sample. We chose to collect adults at eclosion, sexual maturation, post-spawning, and elderly stages separately and then pooled them together. Total RNA was extracted according to the manufacturer's protocol. We examined the quality of RNA using an Agilent 2100 Bioanalyzer.

Small RNA library construction and high-throughput sequencing

RNA fragments 14-30 bases long were isolated from total RNA by Novex 15% TBE-Urea gel (Invitrogen). Then, a 5' adaptor (Illumina, San Diego, CA, USA) was ligated to purified small RNAs followed by purification of ligation products on Novex 15% TBE-Urea gel. The 5' ligation products were then ligated to a 3' adaptor (Illumina) and products with 5' and 3' adaptors were purified from Novex 10% TBE-Urea gel (Invitrogen). Subsequently, these ligation products were reverse transcribed followed by PCR amplification. The amplification products were excised from 6% TBE-Urea gel (Invitrogen). The purified DNA fragments were used for clustering and sequencing by Illumina Genome Analyzer at the Beijing Genomics Institute, Shenzhen.

Discovery of conserved locust miRNA families

We discarded bad reads that were the result of incorrect sequencing or were the reads of adaptor contamination that were not ligated to any other sequences. We clustered the remaining reads based on sequence similarity and the dominant reads were analyzed as follows: the reads were analyzed by BLAST against EST database [13] and FlyBase [17] to discard rRNA, tRNA and snRNA. Subsequently, the remaining sequences were analyzed by BLAST search against miRBase v11.0 [18]. Sequences in our libraries with identical or related (four or fewer nucleotide substitutions) sequences from D. melanogaster or other insects (mosquito, silkworm, and honeybee) were identified as conserved miRNAs.

Discovery of non-conserved locust miRNA families

We first looked at the high-throughput sequencing data of small RNAs in other species, including C. elegans, D. melanogaster, and Arabidopsis [16, 20, 38], and found that star sequences of most miRNAs were also present in the small RNA libraries, and that the miRNA-miRNA* duplexes exhibited 1 or 2 nucleotide 3' overhangs, a characteristic of RNase III enzyme cleavage (Figure 3a). The 5' end sequences of miRNA clusters showed obvious consistency compared with other small RNAs and degradation fragments (Figure 3a). Thus, if a sequence in the locust small RNA libraries is a canonical miRNA, its star sequence should be identified based on imperfect base-pairing and a 1-2 nucleotide 3' overhang when paired with its complementary mature miRNA.

Based on the biogenesis features of miRNA (Figure 3a), we developed a perl script to search for possible candidate miRNA-miRNA* duplexes, which satisfied the following criteria: they were selected primarily by base-pairing, allowing for G:U pairing, which is common in the miRNA precursors they could contain up to four mismatches they could have a maximum size of 4 nucleotides for a bulge in the candidate miRNA sequence they had to have a 1-2 nucleotide 3' overhang [45, 46] the dominant strand had to have five or more reads in the library because miRNAs with a low expression level were likely to have no star form in the library the length of the dominant strand had to be between 18 and 24 nuceotides long the 5' ends in more than 80% of the reads of those sequences in the cluster of the dominant sequence of the pairs had to be consistent with each other. After these criteria were met, we then used mfold to evaluate the ability of the identified pairs to form a hairpin structure [22, 23], where their free energy of folding (ΔG) was an important standard for use in determining the stability of RNA secondary structure.

In order to satisfy the requirement of input sequences analyzed by mfold, we joined the two sequences in each candidate pair using a standard hairpin-forming linker sequence (GCGGGGACGC). Those pairs that met the following conditions were analyzed further: the pairs had a free energy less than or equal to -21 kcal/mol (in cases where there was more than one partner for a sequence, the pair with the lowest free energy was selected as the true one) the pairs had no bulge bigger than 6 nucleotides and multiple loops. The way of determining the best parameters and of testing this method is described in the Methods in Additional data file 3.

Amplification of the miRNA precursors from locust genomic DNA

We extracted genomic DNA from the fifth instar locust using a Gentra Puregene Tissue Kit (Qiagen, Valencia, CA, USA) according to the manufacture's protocol. We designed primers for 8 conserved miRNAs and 24 candidate miRNA-miRNA* pairs we predicted based on a dependence of the sequences of the mature miRNA and miRNA* species using Primer Premier 5.0. (Premier Biosoft International, Palo Alto, CA, USA) Because mature miRNA may come from either arm of the precursor, we designed two pairs of primers for each duplex. Corresponding fragments were amplified by PCR and the length of amplification products was examined on 2.5% agarose gels. Fragments between 55 and 70 nucleotides in length were subcloned into pMD18-T vector (Takara, Dalian, Liaoning, China) for sequencing analyses.

Discovery of endo-siRNAs and piRNA-like small RNAs using ESTs

The 23-29 nucleotide long RNAs matching ESTs annotated as transposons were considered as piRNA-like small RNAs. Those small RNAs that perfectly matched EST antisense strands were considered as candidate endo-siRNAs if they were not from annotated transposons. Moreover, we also searched the ESTs for miRNA precursors. Although there were some sequences that perfectly matched EST sense strands, no typical hairpin structure of these ESTs could be identified using mfold. Rather than folding the entire EST sequence, regions of 70 nucleotides, 100 nucleotides and 150 nucleotides on either side of the small RNA sequences were folded.

Prediction of miRNA targets

Unigene sequences from the EST database of the locust [13, 14] were chosen to predict the miRNA targets without distinguishing the 3' UTR from the protein coding region. miRanda v3.1 [35] was selected as the prediction tool. A miRanda score greater than 150 was used to select unigene targets.

3' RACE of the locust pale gene

The 3' UTR sequence of the locust pale gene was obtained by 3' rapid amplification of cDNA ends (RACE) using a SMART RACE cDNA Amplification Kit (Clontech, Takara, Dalian, Liaoning, China) with the primer GCGACCTGGACAACTGCAACCACCTCAT according to the manufacturer's protocol.


Methodological Challenges

Perhaps as a result of their novelty in conservation science, some central tenets of good qualitative research relevant for studying coexistence are insufficiently applied. These include rigor in recording and presenting qualitative data, reflecting on the researcher's role in the research process, and thinking through research ethics. Good practice is further hindered by mismatches between academic and funding requirements and the time requirements of ethnographic-style research.

Numerous theses and publications present qualitative data imprecisely, in ways that the same researchers would never countenance presenting quantitative data. For example, tables of interviewees that allow attribution of quotations to specific interviewees (not “an old man told me”) are seldom provided (interviews recorded rigorously as data). Transcriptions of interviews or focus groups are seldom referred to. Methods sections are silent on the social contexts in which data were collected, by whom, and how this could have influenced the information gathered.

Self-reflexivity is an important dimension of field research, particularly research on sensitive topics such as human–wildlife conflict and coexistence. Sometimes noted, it is seldom explored in depth. In essence, it refers to researchers reflecting on their identity and how this positions them (and results in them being positioned) relative to their interviewees (Lute & Gore 2019 ). It reminds researchers that they bring strong biases to interview situations and that knowledge is being coproduced.

Researchers are urged to be as transparent as possible in presenting themselves and their research projects to interviewees. This is to the good, but actual field research is more complicated, raising issues around ethnicity, gender, socioeconomic status, and power relations shaping the nature of interactions (Chattopadhyay 2013 ). Researchers build relationships with individuals and communities that may require omitting certain aspects of their personal circumstances and beliefs, for example, religious beliefs, gender identity, sexual orientation, wealth, and access to resources (relative to interviewees).

Being invited to witness or even participate in illegal activities raises dilemmas for researchers. Researchers are not there to judge locals, but there are times when lives are at stake or their personal values are challenged, when they may feel compelled to act to prevent such activities. Participation may offer access to important knowledge but require researchers to be less judgmental. However, when it comes to writing and publication, the intimate relationships and trust that allowed participation become challenging to represent and explain, and communicating may be difficult to achieve without compromising anyone involved (Chattopadhyay 2013 Smith 2016 ). Self-reflexivity and the constraints on objective observation deserve serious attention.

Researchers have an ethical duty to ensure no harm will come to those they are working with, during and after research activities (ASA 2011 ). Asking people to talk about traumatic events and possibly illegal responses to them requires empathy and tact. It requires putting the feelings of interviewees first when conversations become upsetting. Victims of traumatic events should be interviewed with someone close to them present to support them. Learning about peoples’ lives and experiences requires humility because researchers are the learners, not the experts. In addition to those suffering traumatic events, researchers hearing about them also have a duty of care to themselves: both sets of persons should have someone to discuss their experiences with in confidence. Finally, it is advisable to consider the sensitivities of governments and management organizations and ensure publications and public statements do not compromise local collaborators.

Time and funding constraints, especially those faced by early-career researchers, present serious challenge for ethnographic-style work. Postgraduate research projects and short-term grants demand quick results and publication. Undertaking ethnographic research, however, typically takes years. It takes a brave graduate student to arrive at a field site and spend several months doing “informed hanging out” (anthropologist G. Marvin, personal communication 2018). Not doing so, however, and arriving with preformulated ideas and prestructured research instruments seriously compromises researchers’ abilities to discover concepts and questions they had not already thought of. Conceptually, ethnographic researchers try to avoid preconceptions and biases in questions and analyses based on predetermined categories and theoretical perspectives.

Studying coexistence requires slow research and a willingness and capacity to listen carefully to and learn from others. It requires researchers to take the time to approach communities appropriately, get the necessary permissions, make good contacts, win peoples’ trust, learn about their lives beyond just how they interact with wildlife, and above all empathize with them. Interviewees are individuals with unique biographies they are not simply victims, perpetrators, or demographic variables. This work requires giving the care and attentiveness to people that naturalists give to observing nature.

It is remarkable how little attention has been paid to the experiences of (and posttraumatic effects on) people involved in life-changing encounters with wild animals, including attacks and disastrous losses of livestock, food, or crops (Barua et al. 2013 ). There is a management focus on prevention and one-off or short-term compensation measures, but lives may be changed forever and attitudes deeply affected for the long term by such encounters.


Evidence for whale evolution from paleontology

The critical piece of evidence was discovered in 1994, when paleontologists found the fossilized remains of Ambulocetus natans, which means "swimming-walking whale," according to a 2009 review published in the journal Evolution: Education and Outreach. Its forelimbs had fingers and small hooves, but its hind feet were enormous relative to its size. The animal was clearly adapted for swimming, but it was also capable of moving clumsily on land, much like a seal.

When it swam, the ancient creature moved like an otter, pushing back with its hind feet and undulating its spine and tail.

Modern whales propel themselves through the water with powerful beats of their horizontal tail flukes, but A. natans still had a whip-like tail and had to use its legs to provide most of the propulsive force needed to move through water.

In recent years, more and more of these transitional species, or "missing links," have been discovered, lending further support to Darwin's theory. For example, in 2007, a geologist discovered the fossil of an extinct aquatic mammal, called Indohyus, that was about the size of a cat and had hooves and a long tail. Scientists think the animal belonged to a group related to cetaceans such as Ambulocetus natans. This creature is considered a "missing link" between artiodactyls &mdash a group of hoofed mammals (even-toed ungulates) that includes hippos, pigs, and cows &mdash and whales, according to the National Science Foundation.

Researchers knew that whales were related to artiodactyls, but until the discovery of this fossil, there were no known artiodactyls that shared physical characteristics with whales. After all, hippos, thought to be cetaceans' closest living relatives, are very different from whales. Indohyus, on the other hand, was an artiodactyl, indicated by the structure of its hooves and ankles, and it also had some similarities to whales, in the structure of its ears, for example.


Evolution is defined as a change in the allele frequency of population through time. The Hardy-Weinberg model predicts that the allele frequency of a population will not change (i.e., evolution will not occur) if the following conditions are met:

no natural or sexual selection

no gene flow (immigration or emigration from the population)

no genetic drift (changes in allele frequency due to random events)

So we can conclude that if any of the above conditions are not met then there is a change in allele frequency and thus evolution, and thus that factor is the cause of evolution.

What is evolution?

The first step is to remind ourself of the definition of the term "evolution". Evolution is most often defined as "any change in allele frequency in a population". I will assume that you are willing to use this standard definition.

If one were to use another definition of evolution (see How to define “evolution”? for a discussion), of course the below list of mechanisms that are driving evolution would be different.

Forces that drive evolution

Categorizing the processes that affect allele frequencies might be subject to issues of semantics. Without going into the details, we generally recognize 4 forces that drives evolution

  1. Natural selection
    • Natural selection refers to the deterministic change in allele frequency due to a differential in fitness among different genotypes. Sexual selection and artificial selection are typically considered as part of natural selection (although that may vary from author to author)
  2. Genetic Drift
    • Genetic Drift refers to the stochastic sampling process of individuals
  3. Mutations
    • A mutation refers to any spontaneous change (substitution, indel, chromosome duplication, etc. ) in an individual's genotype.
  4. Gene flow (aka. migration)
    • Gene flow refers to the transfer (migration) of DNA sequences among populations.

KennyPeanuts's answer, random mating and hardy-weinberg equilibrium

In his answer, @KennyPeanuts also talk about random mating. Random mating refers to the condition where the probability of two individuals to mate depends only on their respective fitness. Many people phrase random mating as absence of mate choice but it actually refers to the absence of variation for mate choice in the population.

Hardy-Weinberg states that under the above four conditions and random mating, then the frequency of the genotype that has the allele $i$ derived from the mother and the allele $j$ derived from the father, where $x_i$ and $x_j$ are the frequency of these alleles is $cdot x_i cdot x_j$. This means that for a bi-allelic locus, the allele frequency of the genotypes AA , AB , BA and BB are $x^2$, $x(1-x)$, $x(1-x)$ and $(1-x)^2$, respectively where $x$ is the frequency of the allele A . For the heterozygotes ( AB and BA ), we often care little which of the two allele is inherited by the mother and which is inherited by the father (assuming there are genders) and we therefore call AB both AB and BA genotypes (which can eventually be confusing). As such, the frequency of the AB genotype is $2 x(1-x)$.

The condition of random mating ensure that there is no deviation of genotype frequencies from the Hardy-Weinberg's expectations and it ensure that there is no change in genotype frequencies from the first to the second generation considered (after one generation, the equilibrium genotype frequency is immediately reached). Random mating is therefore not a condition for evolution to not occur.


Watch the video: Genetic Drift (June 2022).


Comments:

  1. Tobin

    Don't you like it?

  2. Bagami

    With him in the end you take care?

  3. Taur

    I accept it with pleasure. The question is interesting, I will also take part in the discussion.

  4. Agastya

    I forgot to remember you.

  5. Voodooshakar

    I apologise, but, in my opinion, you are not right. I am assured. Let's discuss. Write to me in PM, we will communicate.



Write a message